Korean J Vet Res > Volume 61(2); 2021 > Article
Moon, Sung, Park, and Kwon: Construction of an avian hepatitis E virus replicon expressing heterologous genes and evaluation of its potential as an RNA vaccine platform

Abstract

To evaluate avian hepatitis E virus (aHEV) as an RNA vaccine platform, ORF2 of aHEV was replaced by heterologous genes, such as eGFP and HA-tag, in aHEV infectious cDNA clones. eGFP and HA-tag replicons were expressed in LMH cells. To confirm expression of the heterologous protein, ORF2 was replaced with the antigenic S1 gene of IBV. The IBVS1 replicon was expressed in LMH cells. To our knowledge, this is the first investigation the showing potential as a RNA vaccine platform using an aHEV. In the future, it may be used in the development of RNA vaccines against various pathogens.

Avian hepatitis E virus (aHEV) has a 5′-capped, positive-sense, single-stranded RNA genome of approximately 6.6 kb and consists of 5′-non-coding regions (NCR), three open reading frames (ORFs), and a 3′ NCR. ORF1 encodes the non-structural proteins, ORF2 encodes an immunogenic capsid protein, and ORF3 encodes a phosphoprotein [1,2]. Infectious cDNA clones that can synthesize the original viral RNA are useful for virus characterization and pathogenicity research. They are also useful vaccine platforms; a replicon can be created by inserting a gene of interest into the structural gene [3]. The RNA genomes of positive-strand RNA viruses have dual functions: they act as an mRNA template for RNA-dependent RNA polymerase (RDRP) and as a genomic template for replication by the respective RDRP. Replicon RNA is readily produced by in vitro transcription from cDNA templates [4,5]. However, no study has reported a replicon vaccine platform using aHEV. Therefore, we explored the possibility of aHEV as a vaccine platform using an aHEV infectious cDNA clone. The ORF2 gene of aHEV was replaced by heterologous genes, such as enhanced green fluorescent protein (eGFP), hemagglutinin (HA)-tag, and infectious bronchitis virus (IBV) S1. The S1 protein of IBV is critical for antigenic neutralization and hemagglutination. IBV infection is a significant problem in the poultry industry, and novel vaccines are needed to combat emerging and variant IBV serotypes [6]. These replicons were constructed and used to transcribe the capped RNA transcripts and to transfect leghorn male hepatoma (LMH) cells. This is the first study of a replicon vaccine platform using aHEV infectious cDNA clones.
The previously constructed genotype 2 aHEV infectious cDNA pT9-aHEV-GI clone and the genotype 1 aHEV infectious cDNA pT11-aHEV-K clone were used in this study [7]. Specific primers were prepared to insert eGFP and an HA-tag into the pT9-aHEV-GI clone (Table 1). The products were subjected to fusion polymerase chain reaction (PCR), amplified by cloning and transformation, and sequenced. Clones containing the consensus sequences of heterologous genes were inserted into ORF2 by digestion with BamHI and KpnI (pTGI-GFP replicon) and with BamHI and XbaI (pTGI-HA replicon) (Fig. 1). Specific primers were prepared to insert eGFP, HA-tag, and IBV S1 into the pT11-aHEV-K clone (Table 1). IBV used K047-12, which was most similar to the QX-like IBV reported previously [8]. The products were subjected to fusion PCR, amplified by cloning and transformation, and sequenced. Clones containing the consensus sequences of heterologous genes were inserted into ORF2 by digestion with AgeI and BamHI (pTK-HA replicon, and pTK-IBVS1 replicon) and with FseI and BclI (pTK-GFP replicon) (Fig. 1). The plasmid DNAs from each replicon were linearized with XbaI (pTGI-GFP and pTGI-HA replicons) or BamHI (pTK-GFP, pTK-HA, and pTK-IBVS1 replicons) and purified by phenol/chloroform extraction and ethanol precipitation. Capped RNA transcripts were synthesized as described previously [7] and used directly for the in vitro transfection. LMH chicken liver cells were transfected with the 500 ng of capped RNA transcripts of the pTGI-GFP, pTGI-HA, pTK-GFP, pTK-HA, and pTK-IBVS1 replicons in 24-well plates using a VIROMER mRNA Kit (Lipocalyx, Germany). To confirm insertion of GFP, we performed IFA using a rhodamine-conjugated anti-GFP IgG (Novus Biologicals, USA) at 5 days post-transfection. The pTGI-HA and pTK-HA replicons were reacted with FITC-conjugated anti-HA-tag IgG (Novus Biologicals) 5 days after transfection. The pTK-IBVS1 replicon was reacted with a primary anti-IBV chicken IgG, followed by a secondary FITC-conjugated rabbit anti-chicken IgG (Sigma, USA) for 5 days, treated with DAPI (Vector Laboratories, USA), and visualized by fluorescence microscopy (Olympus, Japan).
After transfection with the pTGI-GFP and pTK-GFP replicons, expression was monitored daily in LMH cells (Fig. 2A). LMH cells transfected with RNA transcripts synthesized using pTGI-GFP proliferated and expressed eGFP. IFA using an anti-GFP antibody conjugated to rhodamine confirmed that eGFP was expressed in LMH cells (Fig. 2B and C). Also, the expression of pTGI-HA and pTK-HA was detected using a FITC-conjugated antibody (Fig. 2D and E). LMH cells were transfected with RNA transcripts synthesized using the pTK-IBVS1 replicon. After 5 days, IFA using chicken anti-IBV antiserum and a FITC-conjugated secondary antibody confirmed expression of the S1 gene in LMH cells (Fig. 2F). These results indicate that replicons lacking the ORF3 and ORF2 proteins were expressed in LMH cells, resulting in synthesis of ORF3 and ORF2 proteins.
Because GFP-producing cells could be observed in damp cells, green fluorescence was used as a marker of proliferating cells. Expression of eGFP did not prevent cell division and was persistent in cell division, like HEV [9]. Since its introduction almost 20 years ago as a short immunoreactive tag, the hemagglutinin epitope YPYDVPDYA (HA tag) from influenza virus A has been used to track proteins of interest within cells, to isolate them, and to coprecipitate their possible partners [10,11]. Using the HA-tag replicons, HA-tag protein cloned into aHEV was expressed in LMH cells. The S1 gene of IBV K047-12, which is similar in length to the ORF2 gene, was amplified and replaced with ORF2 of aHEV clone pT11-aHEV-K to construct the pTK-IBVS1 replicon. The aHEV pT11-aHEV-K clone was used because it had higher intracellular expression and infectiousness than aHEV pT9-aHEV-GI. This pTK-IBVS1 replicon was expressed in LMH cells, indicating that the aHEV replicon platform can self-amplify in LMH cells. However, further in vivo studies are needed to verify the potential of the aHEV replicon as RNA vaccine platform.
Although ORF3 encodes only 82 amino acids, it has been postulated to have numerous functions. Recombinant ORF3 reacts with the cytoskeleton and with non-glycosylated recombinant ORF2 protein [12]. Additionally, it reportedly exerts regulatory effects by binding to multiple cellular proteins containing SH3 domains and by activating mitogen-activated protein kinase [13]. A segment of the aHEV genome containing most of the ORF3 gene and the complete or partial ORF2 gene was removed, and a heterologous gene was inserted in-frame with the ORF2 methionine initiation codon (Fig. 1). Therefore, replicons were lacking ORF3 and ORF2. As the eGFP replicon of HEV lacking ORF3 and ORF2 proteins was expressed in vitro, aHEV replicons lacking ORF3 and ORF2 proteins were expressed in vitro [9]. Therefore, ORF3 and ORF2 are not required for expression of heterologous genes in vitro.
We developed RNA-based aHEV replicons capable of expressing heterologous genes in LMH cells. To our knowledge, this is the first report of a replicon vaccine platform using aHEV infectious cDNA clones.

Conflict of interest

The authors declare no conflict of interest.

Acknowledgments

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (No. 2017R1A2B4001847) and 2017 Research Grant from Kangwon National University (No. 520170372).

Fig. 1.
Schematic diagram of construction of the avian hepatitis E virus (aHEV) enhanced green fluorescent protein (eGFP), hemagglutinin (HA)-tag, and infectious bronchitis virus (IBV) S1 replicons. (A) Infectious clone backbone of pT11-aHEV-K or pT9-aHEV-GI. (B) eGFP replicon. The front of open reading frame 2 (ORF2) was replaced with eGFP (pTK-GFP and pTGI-GFP). (C) HA replicon. ORF2 was replaced with an HA-tag (pTK-HA and pTGI-HA). (D) IBVS1 replicon. ORF2 was replaced with IBVS1 K047-12 (pTK-IBVS1).
kjvr-2021-61-e11f1.jpg
Fig. 2.
Expression of the heterologous gene replicons in leghorn male hepatoma (LMH) cells. LMH cells were transfected with RNA transcripts of pTGI-GFP, pTK-GFP, pTGI-HA, pTK-HA, and pTK-IBVS1. (A) pTGI-GFP. Transfected cells were observed in damp cells at 2, 3, and 5 days post-transfection; enhanced green fluorescent protein (eGFP) expression was evident in proliferating cells. (B) pTGI-GFP and (C) pTK-GFP. eGFP expression was visualized by FITC (green) and rhodamine (red) staining; blue, DAPI-stained nuclei. (D) pTGI-HA and (E) pTK-HA. Blue, DAPI staining of nuclei; green, FITC staining of HA-tag reporter protein. (F) pTK-IBVS1. Blue, DAPI staining of nuclei; green, FITC staining of IBV spike protein. HA, hemagglutinin; IBV, infectious bronchitis virus.
kjvr-2021-61-e11f2.jpg
Table 1.
Oligonucleotide primers used to construct eGFP, HA-tag, and IBVS1 replicons
Primers Primer sequence (5′ to 3′)
GI-BamHI3538F3 GCGCAGTTCTGGCACCACATTGAG
GI-eGFP_4706_R CTCACCATCCCACCCCACTTTCCTGGCACT
GI-eGFP_4698_F GGGGTGGGATGGTGAGCAAGGGCGAGGA
GI-eGFP_KpnI_R GCGGTACCTTACTTGTACAGCTCGTCCATG
GI-HA-tag_SbfI_R TTAAGCGTAATCTGGAACATCGTATGGGTACATCCCACCCCACTTTCCTGGCACTCCAGAC
GI-3’-NCR_F CGATGTTCCAGATTACGCTTAATGCTGTGGTTTTGGGGCTTAGGTTAAT
GI-T18SbfIR4 GCCCTGCAGGTTTTTTTTTTTTTTTTTTACTATGCCCGAAATGGGAGG
K-AgeI2848F3 CGCGCCGATTATCCAACTA
K_HA-tag_BamHI_R TTAAGCGTAATCTGGAACATCGTATGGGTACATCCCACCCCACTATCCTGACACTCCAGAC
K_3’NCR_F CGATGTTCCAGATTACGCTTAATAAGACTATGGATTGGGGTGTAAATTG
F_ORF2-GFP TCAGGATAGTGGGGTGGGATGGTGAGCAAGGGCGAGGAGCTGTTC
R_FseI-GFP GCGGCCGGCCCTATTACTTGTACAGCTCGTCCATGC
F_ORF1-BclI GCAGTCAAATCCCGGGTCGATTA
R_ORF1-GFP CATCCCACCCCACTATCCTGA
IBV47S1_F GCGCAGTTCTGGCACCACATTGAG
IBV47S1_R ACGTCTAAAACGACGTGTCT
K_ORF1-IBV47_R CCAACATCCCACCCCACTATCCTGACA
K_3NCR-IBV47_F TAGACGTTAAGACTATGGATTGGGGTG
K-T18BamHIR4 GCGGATCCTTTTTTTTTTTTTTTTTTACTATGCCCGAGATGGGA

eGFP, enhanced green fluorescent protein; HA, hemagglutinin; IBV, infectious bronchitis virus.

References

1. Meng XJ, Shivaprasad HL. Avian Hepatitis E Virus Infections. In: Swayne DE, Boulianne M, Logue CM, McDougald LR, Nair V, Suarez DL, de Wit S, Grimes T, Johnson D, Kromm M, Prajitno TY, Rubinoff I, Zavala G, Diseases of Poultry. 14th ed. p. 528-534. John Wiley & Sons, Hoboken (NJ), 2020.
2. Sun P, Lin S, He S, Zhou EM, Zhao Q. Avian hepatitis E virus: with the trend of genotypes and host expansion. Front Microbiol 2019;10:1696.
crossref pmid pmc
3. Perri S, Greer CE, Thudium K, Doe B, Legg H, Liu H, Romero RE, Tang Z, Bin Q, Dubensky TW Jr, Vajdy M, Otten GR, Polo JM. An alphavirus replicon particle chimera derived from venezuelan equine encephalitis and sindbis viruses is a potent gene-based vaccine delivery vector. J Virol 2003;77:10394-10403.
crossref pmid pmc
4. Karikó K, Muramatsu H, Welsh FA, Ludwig J, Kato H, Akira S, Weissman D. Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. Mol Ther 2008;16:1833-1840.
crossref pmid pmc
5. Kauffman KJ, Webber MJ, Anderson DG. Materials for non-viral intracellular delivery of messenger RNA therapeutics. J Control Release 2016;240:227-234.
crossref pmid
6. Jackwood MW. Review of infectious bronchitis virus around the world. Avian Dis 2012;56:634-641.
crossref pmid
7. Park SJ, Lee BW, Moon HW, Sung HW, Yoon BI, Meng XJ, Kwon HM. Construction of an infectious cDNA clone of genotype 1 avian hepatitis E virus: characterization of its pathogenicity in broiler breeders and demonstration of its utility in studying the role of the hypervariable region in virus replication. J Gen Virol 2015;96(Pt 5):1015-1026.
crossref pmid pmc
8. Moon HW, Sung HW, Kwon HM. Genomic characteristics of natural recombinant infectious bronchitis viruses isolated in Korea. Korean J Vet Res 2019;59:123-132.
crossref
9. Emerson SU, Nguyen H, Graff J, Stephany DA, Brockington A, Purcell RH. In vitro replication of hepatitis E virus (HEV) genomes and of an HEV replicon expressing green fluorescent protein. J Virol 2004;78:4838-4846.
crossref pmid pmc
10. Schembri L, Dalibart R, Tomasello F, Legembre P, Ichas F, De Giorgi F. The HA tag is cleaved and loses immunoreactivity during apoptosis. Nat Methods 2007;4:107-108.
crossref pmid
11. Wang J, Qin Y, Qin H, Liu L, Ding S, Teng Y, Ji J, Qiu L, Jiang P. Simultaneous detection of assembly and disassembly of multivalent HA tag and anti-HA antibody in single in-capillary assay. Electrophoresis 2016;37:2163-2169.
crossref pmid
12. Tyagi S, Korkaya H, Zafrullah M, Jameel S, Lal SK. The phosphorylated form of the ORF3 protein of hepatitis E virus interacts with its non-glycosylated form of the major capsid protein, ORF2. J Biol Chem 2002;277:22759-22767.
crossref pmid
13. Korkaya H, Jameel S, Gupta D, Tyagi S, Kumar R, Zafrullah M, Mazumdar M, Lal SK, Xiaofang L, Sehgal D, Das SR, Sahal D. The ORF3 protein of hepatitis E virus binds to Src homology 3 domains and activates MAPK. J Biol Chem 2001;276:42389-42400.
crossref pmid


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
#401-1, 85 Bldg., College of Veterinary Medicine, Seoul National University
1 Gwanak-ro, Gwanak-gu, Seoul 08826, Korea
Tel: +82-2-880-1229    Fax: +82-2-878-9762    E-mail: jvs@ksvs.or.kr                

Copyright © 2021 by The Korean Society of Veterinary Science.

Developed in M2PI

Close layer
prev next