Korean J Vet Res > Volume 63(1); 2023 > Article
Carrillo-Godoy, Rueda-Garcia, Uribe-Garcia, and Rondón-Barragán: Prevalence of infectious reproductive diseases in sows from Tolima-Colombia

Abstract

The prevalence of some swine reproductive and zoonotic diseases in Colombia is still unknown, making their management difficult. This study assessed the prevalence of porcine circovirus type 3 (PCV3), Leptospira interrogans, pseudorabies virus, and porcine gamma-herpesvirus by polymerase chain reaction in sows in the productive stage, from farms with a history of reproductive failures, at the department of Tolima. The prevalence of PCV3 was 2.6% and 12.6% for L. interrogans, with some samples co-infected with PCV2. Owing to the coinfections with PCV2, it is necessary to establish whether the interactions between these pathogens were related to the presence of reproductive problems.

Some infections in pigs can induce reproductive insufficiency, including embryonic loss, mummifications, stillbirths, weak newborns, and growth retardation in piglets. Pathogens, such as porcine circovirus [1], pseudorabies virus (PRV) [2], and Leptospira interrogans [3], have been associated with reproductive failure in pigs.
These infections can be asymptomatic, causing only reproductive problems; some can be zoonotic. Leptospirosis, one of the most widespread bacterial diseases, shows variability in its pathogenicity [3]. Similarly, infection with a PRV variant has now been demonstrated in people with neurological signs [4].
The porcine lymphotropic herpesvirus (PLHV) is circulating widely in pig populations [5]. Although the clinical implications in pigs have not been investigated thoroughly [6], interest in this pathogen focuses on post-transplant lymphoproliferative diseases it can cause in pigs and humans [5].
Currently, in Colombia, the prevalence and distribution of several pathogens and the health status of herds at the national level are unknown. Hence, it is necessary to generate control measures because of the increased costs of treatment and sanitary management [2]. For this reason, this study examined the prevalence of porcine circovirus type 3 (PCV3), PLHV (1, 2, and 3), PRV, and L. interrogans in the department of Tolima, using molecular techniques to expand the information available on the circulation of these pathogens in Colombia.
All procedures involving animals were approved by the Ethics Committee of the University of Tolima based on Law 84/1989 and Resolution 8430/1993 and complied with the guidelines for animal care and use in research and teaching [7].
The samples were taken from breeding sows (n = 150) older than 250 days in five municipalities of the department of Tolima coming from farms with a record of reproductive problems, but there was no discrimination between sows with or without reproductive failure. The sample distribution was as follows: Ibagué (n = 15), Falan (n = 35), Chaparral (n = 15), Purificación (n = 35), and Cajamarca (n = 50). Whole blood was obtained by venipuncture of the jugular vein using the BD Vacutainer System (Becton, Dickinson and Company, USA). gDNA was extracted from the blood samples using the Wizard Genomic DNA purification Kit (Promega, USA) according to the manufacturer’s recommendations.
The DNA quality was verified by polymerase chain reaction (PCR) amplification of a fragment of the reference gene gapdh (glyceraldehyde-3-phosphate dehydrogenase). PCV3 was detected by amplifying the cap gene, and L. interrogans was detected by amplifying the LipL32 gene. PRV, PLHV1, PLHV2, and PLHV3 were detected by amplifying the glycoprotein B gene (gB) using the specific primer for each pathogen (Table 1). For Leptospira detection, a positive control was used, which corresponds to the DNA from L. interrogans Serovar Icterohaemorrhagiae coming from a fresh culture extracted using a PureLink Genomic DNA Mini Kit (Invitrogen, USA). Positive control was gently donated by Professor Libardo Enrique Caraballo Blanco, Faculty of Education and Science, Department of Biology, Biomedical Research Group from the University of Sucre.
PCR was performed using a ProFlex PCR System (Applied Biosystems, USA) using Green GoTaq Flexi Buffer (Promega), according to the manufacturer's conditions. Amplicons were revealed on 2% agarose gel by electrophoresis (PowerPac HC; Bio-Rad, USA) using GeneRuler 100 bp DNA Ladder (Thermo Fisher Scientific, USA). The gel was stained with HydraGreen (ACTGene, USA) and visualized with UV light using an ENDURO GDS gel documentation system (Labnet International Inc., USA).
The gDNA extracted from the blood samples showed quality values according to biomolecule spectrophotometry that were optimal for processing by PCR. In addition, all samples were considered good quality because the gapdh gene had been amplified correctly. The samples were used to detect the pathogens, where positive samples were detected for PCV3 and L. interrogans, regardless of whether these infected animals had reproductive failures.
PCV3 was detected by amplifying a fragment of 329-base pairs (bp) of the cap gene by endpoint PCR. Four samples (4/150, 2.7%) were positive, showing the band of the expected size on the electrophoresis assay (Fig. 1A).
In the case of L. interrogans, a 165-bp fragment of the gene that encodes for the LipL32 lipoprotein was amplified by endpoint PCR. Nineteen samples (19/150, 12.7%) were positive, showing the band of the expected size (Fig. 1B).
Previously, the authors’ laboratory assessed the prevalence of PCV2 in these samples using molecular techniques [8]; thus, coinfection with PCV3 and L. interrogans was identified. Hence, 50% and 100% of the positive samples for PCV3 and L. interrogans, respectively, were also positive for PCV2 (Table 2) [8].
In the present study, samples were taken from farm animals with a record of reproductive problems. PCV3- and L. interrogans-positive individuals were detected by PCR. Some showed coinfection with PCV2 based on a previous study [8]. Owing to this coinfection condition and the lack of complete information on the sanitary status of each animal, it was difficult to discriminate the causal origin of the reproductive problems in the farms, which can be multifactorial and even be associated with the interaction of the pathogens in the animal. Nevertheless, previous studies reported a lack of interaction between PCV3 and PCV2 [9]. In addition, no vaccination for PCV3 is available in Colombia, which means PCV3-positive animals by vaccination is impossible. Moreover, the risk factors associated with PCV3 infections should be reviewed, including biosafety management in pig farms.
Several studies on PCV3 detection take serum samples because of the high PCV3 loads, which exceeded 103 (4.93 log genomic copies/mL) [1], but previous studies showed that the serum might not be a suitable sample for PCVs detection mainly for the low viral load samples [8,10]. For this reason, whole blood was used to detect PCV3 in the present study. In the same way, whole blood samples are suitable for the molecular detection of Leptospira spp. [3] and PLHV [6]. In the case of PRV, nervous tissues are more suitable for diagnosis because of the limited circulation of the virus in the blood, which may explain the negative results in the present study [5,11].
On the other hand, for a diagnosis of herpesviruses, serological methods are preferred because its detection in blood by PCR is not always possible [2] owing to the periods of viral latency [5]. This may be a cause of the negative results of this study, even though a higher number of copies of the PLHV genome in blood has been reported [6].
Since the first report of PCV3, several countries in Europe, Asia, and America have detected the presence of the virus, despite a low prevalence in the animals tested. On the other hand, a prevalence of 97% has been reported in Brazil [12]. In Colombia, a prevalence of 43.5% was demonstrated in groups of sera and 52.6% in tissues that showed genetic material of the virus [13]. These results are considerably higher than those reported in the present study, where a prevalence of 2.6% was established in the department of Tolima.
Similarly, the presence of Leptospira is reported in countries in America, Africa, and Europe. In the present study, a prevalence of 12.6% was shown in the department of Tolima, which is similar to those previously reported in Meta of 12.5%, compared to the reported seroprevalence of 89.2% [14], which may indicate that pigs in the country are frequently exposed to the pathogen despite the low prevalence of infection. On the other hand, the specificity of the primers for the gene encoding for LipL32 allowed the detection of pathogenic Leptospira, even though the infecting serotype was not identified. In Colombia, the circulation of the serovars Bratislava and Icterohaemorrhagiae has been reported in pig production [14].
In South America, the only country that reports the prevalence of PLHV is Brazil, with 50% [5], even though at the beginning of this decade, it was reported that it was distributed widely in the domestic pig population [6]. In the present study, no sows showed the presence of DNA from these viruses in their blood, possibly because of the aforementioned problems with this type of tissue. On the other hand, PRV eradication has been reported in many Asian and European countries, as well as the United States [2], except for China and Italy, where vaccination failures have been reported due to variants of the virus [2,4]. In Colombia, the Instituto Colombiano Agropecuario declared the country a zone free of PRV infections through serological surveys carried out from 2015 to 2019 [15], which is consistent with the present results.
The coinfection rate of PCV3 with PCV2 was 50%, which is considerably higher than that previously reported in Colombia (6.4% in serum pools) [13]. In Brazil, the coinfection rate is 26.4% [12]. Similarly, coinfection between Leptospira with PCV2, PCV3, and porcine parvovirus has been reported [12]. PCV2 interacts with other pathogens generating an exacerbation of the disease [9], but it is unknown whether this can occur between coinfection with PCV3 or L. interrogans under the present conditions.
Sows of the department of Tolima revealed infections with PCV3 and L. interrogans, as well as coinfections with PCV2, in animals regardless of the clinical signs. It is necessary to establish the relationship of coinfection with reproductive failures in sows, and its associated risk factors and, based on molecular techniques, characterize the pathogens to establish surveillance and control measurements in this Colombian region. Similarly, the design of biosecurity strategies in pig farms will help reduce the risk of infection in animals and humans with pathogens with zoonotic potential.

Conflict of interest

The authors declare no conflict of interest.

Acknowledgments

This study was supported by the Laboratory of Immunology and Molecular Biology (LIBM) of the University of Tolima, Colombia.

Fig. 1.
(A) Amplification of the porcine circovirus type 3 (PCV3) cap gene (329 bp) in blood samples from sows in the production stage in the department of Tolima: well 1, individual 001; well 2, individual 002; well 3, individual 004; well 4, individual 007; well 5, individual 008. MW, 100 bp molecular weight marker (New England Biolabs, USA). 2% agarose gel. (B) Amplification of a fragment of the LipL32 gene (165 bp) from Leptospira interrogans in blood samples from sows in the production stage in the department of Tolima. In the gel, the samples from 1 to 19 correspond to 68, 69, 79, 106, 107, 108, 109, 117, 119, 120, 129, 136, 139, 140, 143, 144, 146, 148, and 150 corresponding to the municipality of PF and CJA. 20, Positive control; MW, 100 bp MW marker (New England Biolabs). (C) Distribution map of positive samples for PCV3 and L. interrogans in the present study. For PCV3, IBG was the only one with detection of this pathogen. For L. interrogans, positive samples were found in the municipality of PF (2/19) and in a greater proportion in the municipality of CJA (18/19) (indicated with green), with 94.7% of the samples positive for this pathogen. CJA, Cajamarca; FL, Falán; CHL, Chaparral; PF, Purificación; IBG, Ibagué.
kjvr-20220039f1.jpg
Table 1.
Sequences of primers used for polymerase chain reaction in samples from sows, Sus scrofa
Gene Sense Sequence (5’-3’) Temperature (ºC) Amplicon size (bp) Accession no.
gapdh F ATCAAGAAGGTGGTGAAGCAGG 60 208 396823
R CCCCAGCATCAAAAGTGGAAGA 60.8
cap F CCACAGAAGGCGCTATGTC 58.32 329 MK580467.1
R CCGCATAAGGGTCGTCTTG 58.32
LipL32 F CACAATCCCAGGGACAAAC 56.1 165 NC_004342.2
R ATTTCAGCGATTACGGCAG 56.11
gB PRV F ACAAGTTCAAGGCCCACATC 58.38 194 MK991831
R GGTCACCTTGTGGTTGTTGC 59.90
gB PLHV 1 F ACAGCGACCTGGTCTACTGAATC 61.9 61 AF478169
R GGCTTGAATCGTGTGTTCCA 58.7
gB PLHV 2 F GCTGCCAATAGGTCAATATGGAA 58.86 62 AY170316
R TTTCGCTGGTTGCTCTTTCA 58.33
gB PLHV 3 F AACAGCGCCAGAAAAAAAGG 57.78 66 AY094619
R GGAAAGGTAGAAGGTGAACCATAAAA 59.28

gapdh, glyceraldehyde-3-phosphate dehydrogenase; gB, glycoprotein B; PRV, pseudorabies virus; PLHV, porcine lymphotropic herpesvirus.

Table 2.
Consolidation of samples positive for PCV3, Leptospira interrogans and coinfection with PCV2 [8]
Sample # 2 4 7 8 69 79 106 107 108 109 117 119 120 129 136 139 140 143 144 146 148 150
PCV3 + + + + - - - - - - - - - - - - - - - - - -
L. interrogans - - - - + + + + + + + + + + + + + + + + + +
PCV2 - - + + + + + + + + + + + + + + + + + + + +
Origin IBG IBG IBG IBG PF PF CAJ CAJ CAJ CAJ CAJ CAJ CAJ CAJ CAJ CAJ CAJ CAJ CAJ CAJ CAJ CAJ

PCV3, porcine circovirus type 3; PCV2, porcine circovirus type 2; IBG, Ibagué; PF, Purificación; CAJ, Cajamarca.

References

1. Vargas-Bermúdez DS, Vargas-Pinto MA, Mogollón JD, Jaime J. Field infection of a gilt and its litter demonstrates vertical transmission and effect on reproductive failure caused by porcine circovirus type 3 (PCV3). BMC Vet Res 2021;17:150.
crossref pmid pmc pdf
2. Zhang L, Ren W, Chi J, Lu C, Li X, Li C, Jiang S, Tian X, Li F, Wang L, Dong Z, Yan M. Epidemiology of porcine pseudorabies from 2010 to 2018 in Tianjin, China. Viral Immunol 2021;34:714-721.
crossref pmid
3. Hu W, Lin X, Yan J. Leptospira and leptospirosis in China. Curr Opin Infect Dis 2014;27:432-436.
crossref pmid
4. Liu Q, Wang X, Xie C, Ding S, Yang H, Guo S, Li J, Qin L, Ban F, Wang D, Wang C, Feng L, Ma H, Wu B, Zhang L, Dong C, Xing L, Zhang J, Chen H, Yan R, Wang X, Li W. A novel human acute encephalitis caused by pseudorabies virus variant strain. Clin Infect Dis 2021;73:e3690-e3700.
crossref pmid pdf
5. Dall Agnol AM, Leme RA, Suphoronski SA, Oliveira TE, Possatti F, Saporiti V, Headley SA, Alfieri AA, Alfieri AF. Porcine lymphotropic herpesvirus DNA detection in multiple organs of pigs in Brazil. Braz J Microbiol 2020;51:2145-2152.
crossref pmid pmc pdf
6. Franzo G, Drigo M, Legnardi M, Grassi L, Menandro ML, Pasotto D, Cecchinato M, Tucciarone CM. Porcine gammaherpesviruses in Italian commercial swine population: frequent but harmless. Pathogens 2021;10:47.
crossref pmid pmc
7. Clark JD, Gebhart GF, Gonder JC, Keeling ME, Kohn DF. Special report: the 1996 guide for the care and use of laboratory animals. ILAR J 1997;38:41-48.
crossref pmid
8. Uribe-García HF, Suarez-Mesa RA, Rondón-Barragán IS. Survey of porcine circovirus type 2 and parvovirus in swine breeding herds of Colombia. Vet Med Sci 2022;8:2451-2459.
crossref pmid pmc pdf
9. Woźniak A, Miłek D, Bąska P, Stadejek T. Does porcine circovirus type 3 (PCV3) interfere with porcine circovirus type 2 (PCV2) vaccine efficacy? Transbound Emerg Dis 2019;66:1454-1461.
pmid
10. Kedkovid R, Woonwong Y, Arunorat J, Sirisereewan C, Sangpratum N, Kesdangsakonwut S, Tummaruk P, Teankum K, Assavacheep P, Jittimanee S, Thanawongnuwech R. Porcine circovirus type 3 (PCV3) shedding in sow colostrum. Vet Microbiol 2018;220:12-17.
crossref pmid
11. Ciarello FP, Moreno A, Miragliotta N, Antonino A, Fiasconaro M, Purpari G, Amato B, Ippolito D, Di Marco Lo Presti V. Aujeszky’s disease in hunting dogs after the ingestion of wild boar raw meat in Sicily (Italy): clinical, diagnostic and phylogenetic features. BMC Vet Res 2022;18:27.
crossref pmid pmc pdf
12. Dal Santo AC, Cezario KC, Bennemann PE, Machado SA, Martins M. Full-genome sequences of porcine circovirus 3 (PCV3) and high prevalence in mummified fetuses from commercial farms in Brazil. Microb Pathog 2020;141:104027.
crossref pmid
13. Vargas-Bermudez DS, Mogollón JD, Jaime J. The prevalence and genetic diversity of PCV3 and PCV2 in Colombia and PCV4 survey during 2015-2016 and 2018-2019. Pathogens 2022;11:633.
crossref pmid pmc
14. Ospina-Pinto MC, Hernández-Rodríguez P. Identification of Leptospira spp. in the animal-environment interface (swine-water) in pig production cycle. Trop Anim Health Prod 2021;53:155.
crossref pmid pdf
15. Instituto Colombiano Agropecuario (ICA). RESOLUCIÓN No. 091960 [Internet]. Bogotá: ICA; 2021 [cited 2021 Feb 26]. Available from: https://www.ica.gov.co/getattachment/1c3631f7-0f9f-487a-8d85-069fea9e8225/2021R91960.aspx#:~:text=Que%20en%20Colombia%2C%20no%20se,de%20la%20Enfermedad%20de%20Aujeszky.


About
Browse articles
For contributors
Policy
Editorial Office
#401-1, 85 Bldg., College of Veterinary Medicine, Seoul National University
1 Gwanak-ro, Gwanak-gu, Seoul 08826, Korea
Tel: +82-2-880-1229    Fax: +82-2-878-9762    E-mail: jvs@ksvs.or.kr                

Copyright © 2023 by The Korean Society of Veterinary Science.

Developed in M2PI

Close layer
prev next