Korean J Vet Res > Volume 64(4); 2024 > Article
Kim, Kwon, Yoon, and Kim: Edema disease in two gold-spotted pond frogs (Pelophylax chosenicus) raised in captivity: two case reports

Abstract

Two gold-spotted pond frogs (Pelophylax chosenicus) experienced anorexia, buoyancy without diving, and systemic swelling for 1 month and died several days later. On necropsy, the liver had protruding dark gray nodules scattered on its surface, and the kidneys were fat-like beige. Bacteriology showed the presence of Citrobacter braakii, Delftia acidovorans, Elizabethkingia spp., and Chryseobacterium indologenes. On microscopy, the liver showed melanomacrophagic aggregates, inflammatory cell infiltration, and fibrosis. In the case of these frogs, the edema disease is suspected to have been caused by long-term exposure to chlorine and chloramines in tap water rather than infection.

Gold-spotted pond frogs (Pelophylax chosenicus) inhabit wetlands and are found in ponds and rice paddies in the southern and western Korean Peninsula [1]. Previous studies showed that amphibians are facing unprecedented threats to their populations. Specifically, the population of gold-spotted frogs has been declining probably owing to habitat degradation [2]. Therefore, the International Union for Conservation of Nature’s Red List of Vulnerable Species and the Korean included gold-spotted frogs as endangered wild animals and plants list class II [3]. Subcutaneous edema disease of amphibians is characterized by excessive fluid in the subcutaneous lymph sacs, which is caused by degenerative renal dysfunction and decreased ability of the kidneys to process fluid loads [4]. Differential diagnosis identified several bacterial infections, including red leg syndrome of Aeromonas hydrophila, Chryseobacterum spp., Mycobacterium spp., and Chlamydia spp.; viral infections, including Ranavirus and Lucke herpesvirus; and fungal infections, including Batrachochytrium dendrobatidis (Bd) and Saprolegnia spp. [2,5]. Amphibians are frequently asymptomatic until late disease, presenting with anorexia, weight loss, and fluid retention. Sick frogs tend to have buoyancy problems: they float on the water surface and are reluctant to dive [6,7]. The amphibian disease remains in the infancy stage in captivity [5,7]. Since the cause is unclear, factors relating to husbandry environment might be involved [6]. To our knowledge, subcutaneous edema disease in gold-spotted pond frogs has never been reported in Korea. Here, we describe a rare case of subcutaneous edema disease in gold-spotted pond frogs in captivity.
Two 6-year-old gold-spotted pond frogs (P. chosenicus) (1 male and 1 female) experienced anorexia, buoyancy without diving, and systemic swelling for 1 month and died several days after (Table 1). For more than 5 years, the frogs have been housed for a conservation study in small groups in polycarbonate tanks with a shallow water environment and a small artificial decoration rock at the Research Center for Endangered Species located in the Middle Eastern area of South Korea (36°64’N, 129°15’E) (Fig. 1A). They were fed with crickets (Acheta demesticus) and sprinkled with minerals and vitamins [8]. Tap water that had stood for 1 day was supplied to the tank. Temperature, humidity, and pH levels were checked daily. The temperature and humidity were maintained at an average of 20℃ to 22℃ and 50% to 60%, respectively. Tank water pH ranged from 8.28 to 8.75. Necropsy was performed according to standard protocol to identify the cause of death [9]. The carcass was severely swollen (Fig. 1B). The dorsal surface of the body was dark green, and the ventral surface and extremities were beige without wounds, ulcers, or nodules. The body length of the 2 frogs was 120 and 95 mm, and the weight was 91.5 and 46 g, respectively. A lumpy translucent exudate was observed around the oral cavity (Fig. 1C). Watery fluid was stored in the abdominal cavity (Fig. 1D). The liver was dark red, with white spots scattered on its surface. The lungs, heart, and kidneys were pale. In the female frog, several protruding dark gray nodules were scattered on the liver surface (Fig. 1E), and the kidneys were fat-like beige (Fig. 1F). Samples, including the heart, liver, kidneys, skin, ascitic fluid, and subcutaneous materials, were collected immediately following death and requested by Green Vet Laboratories (Yongin, Korea). The identification of bacteria was performed using the VITEK 2 system (BioMérieux, France), and histopathological examination was performed using hematoxylin and eosin (H&E) and Ziehl-Neelsen (ZN) staining methods [5,8]. Bacteriologic examination results identified Citrobacter braakii in the heart of the female frog, Delftia acidovorans in the ascitic fluid, and Elizabethkingia spp. and Chryseobacterium indologenes in the subcutaneous materials of both frogs (Table 1). Histopathological examination by H&E staining showed edematous epidermis, enlarged blood vessels, and a longitudinally expanded mucous gland of the skin (Fig. 2A). In the liver, parenchymal and perivascular lesions showed marked infiltration with heterophils and mononuclear inflammatory cells and scattered melanomacrophagic aggregates in the parenchyma. The hepatic sinusoid was unclear owing to extremely abundant inflammatory cells, and fibrous tissues were observed around the site of vascular epithelial degeneration. The liver also showed hydropic degenerations (Fig. 2B). Acid-fast bacteria were also identified in the liver of the female frog using ZN staining (Fig. 2D). In the kidneys, glomerular and tubular necrosis and hydropic degeneration of the renal tube epithelium due to swelling were noted (Fig. 2C). Samples, including the skin, liver, and tank water, underwent polymerase chain reaction (PCR) tests to identify etiologic agents, including Ranavirus and chytrid fungus (Bd) [10,11]. DNA samples were extracted using a DNA Extraction kit (Qiagen Korea, Korea) according to the manufacturer’s guidelines. Identification of Ranavirus was performed using a major capsid protein gene with PCR amplification primers (F:5`GACTTGGCCACTTATGAC3` and R: 5`GTCTCTGGAGAAGAAGAA3`). The presence of chytridiomycosis was investigated using a nested PCR assay to detect Bd [12]. Bd18SF1 (5`TTTGTACACACCGCCGTCGC3`) and Bd28SR1 (5`ATATGCTTAAGTTCAGCGGG3`) were the first used primers. The second PCR test used primer BD1A (5’CAGTGTGCCATATGTCACG3’) and BD2A (5’CATGGTTCATATCTGTCCAG3’) genes as PCR targets, as previously described [10,11,13]. PCR results identified no microorganisms in frogs.
Frog edema disease is a condition characterized by excess fluid accumulation in the body that can lead to swelling, particularly in the abdomen and limbs [7]. It can be caused by several factors, including bacteria, viruses, parasites, nutritional deficiencies, toxins, and environmental stress [4,5]. Tap water contains disinfectants, including chlorine and chloramines, which are unsafe for frogs and must therefore be removed [8]. Chloramines are more stable than chlorine and do not evaporate from the water surface as readily as chlorine; therefore, chloramine levels will not decrease in standing tap water [14]. Consequently, allowing chloraminated tap water to stand for 24 to 36 hours before its use in frog housing tanks is ineffective, and chloramines must be removed by special catalytic carbon-activated filters [8]. Chloramine and chlorine toxicity can be associated with eye irritation, skin sloughing, and acute death in frogs without initial clinical signs [2,7]. In this case, tap water was supplied to the tank after standing for 24 hours without using any filters, which is considered to be one of the causes of edema disease. Frogs can live in water with a pH ranging from 6.0 to 9.0. However, they normally prefer slightly alkaline environments (pH, 7.4-7.5), such as tank water. The pH level influences the 2 forms of ammonia detected in water, including ionized and unionized ammonia [14]. Water with high pH has a higher fraction of unionized ammonia [14]. This study recorded water pH levels of 8.28 to 8.75, presumably indicating alkalinized tank water due to unionized ammonia excreted by the same housing tank water. Gold-spotted pond frogs have average body weight and length of 21.6 ± 1.7 g and 60.4 ± 2.08 mm, respectively [3]. However, in this case, the male and female body weights were 91.5 g and 46 g, and their body lengths were 120 mm and 95 mm, respectively, much larger than the average. Therefore, the body size probably changed owing to edema disease in which subcutaneous water is accumulated. Isolated bacteria, including C. braakii in the heart, D. acidovorans in the ascitic fluid, and Elizabethkingia spp. and C. indologenes in subcutaneous materials, are widely distributed in various water environments [15-17]. Owing to their biofilm-forming ability, bacteria are frequently isolated from tap water, which can resist chlorination and survive in water supplies [17]. Consequently, isolates represent bacteria emerging in human public health that can cause nosocomial and community infections [15,16]. In frogs, Elizabethkingia spp. can cause neurological signs, including wryneck, body bias, cataracts, and meningoencephalitis [17-19]. These clinical signs were not observed in this case; however, they should be noted in various water systems. Furthermore, this microorganism was not isolated from the liver. Instead, acid-fast bacteria were observed, indicating the possibility of Mycobacterium spp., an opportunistic pathogen associated with ulcerative systemic disease and visceral granulomas in amphibians [7]. Thus, the scattered liver nodules are believed to be caused by unidentified Mycobacterium spp. infection. In previous experimental studies, frogs exposed to insecticides developed hepatocyte vacuolization, increased melanomacrophage levels, sinusoidal dilatations, hemorrhage, and congestion in the liver. Additionally, the kidneys showed mononuclear cell infiltration, necrosis, karyolysis, glomerular shrinkage, hemorrhage, and fibrosis in the renal tube epithelium [4,9]. Similar observations, including increased melanomacrophages, fibrosis, inflammatory cell infiltration, liver degeneration, glomerular necrosis, tubular necrosis, and kidney degeneration, were noted in this case. Therefore, the liver and kidneys were damaged, assumingly caused by long-term exposure to chlorine and chloramine. PCR tests for Ranavirus and B. dendrobatidis, which are fatal to amphibians and suspected pathogens in edema disease, were negative [10,12]. Therefore, infection is not considered a cause of edema disease. Edema disease in frogs, also called dropsy, bloat, or hydropsy, presents with lethargy, loss of balance, loss of color, red spots on the skin, and weight loss [2]. Edema can be prevented by providing proper care and housing for the frogs, including clean water, a balanced diet, adequate space, and minimal handling. The disease can be fatal if left untreated; therefore, optimal preventive management is significant [7,14,20].

Notes

The authors declare no conflict of interest.

Author’s Contributions

Conceptualization: Kim KT; Data curation: Kim HJ, Kwon K, Yoon J; Formal analysis: Kim HJ; Investigation: Kwon K, Yoon J; Methodology: Kim KT, Kim HJ; Project administration: Kim KT, Yoon J; Resources: Kwon K; Software: Kim HJ; Supervision: Kim KT, Yoon J; Validation: Kim HJ, Kwon K, Kim KT; Visualization: Kim HJ; Writing-original draft: Kim HJ; Writing-review & editing: Kim HJ, Kwon K, Yoon J, Kim KT.

Funding

This work was supported by a grant from the National Institute of Ecology, funded by the Ministry of Environment of the Republic of Korea (NIE-B-2023-45, NIE-B-2024-45).

Acknowledgments

We thank the project members of the Research Center for Endangered Species, National Institute of Ecology who assisted with the necropsy of the gold-spotted pond frogs.

Data Availability Statement

All datasets are available in the main manuscript.

Fig. 1.
Subcutaneous edema disease identified in gold-spotted frogs (Pelophylax chosenicus). (A) The frogs are housed in small groups with shallow water and artificial rock. (B) The male frog is severely swollen. (C) The male frog has lumpy translucent exudates in the oral cavity. (D) The female frog shows numerous fluid exudates in the subcutaneous layer. (E) The female frog’s liver has several protruding dark gray nodules (arrow). (F) The female frog’s kidneys show beige color discoloration (arrow).
kjvr-20240043f1.jpg
Fig. 2.
Histopathologic examinations of subcutaneous edema disease in gold-spotted pond frogs (Pelophylax chosenicus). (A) The male frog’s skin shows edematous epidermis, enlarged blood vessels (white arrows), and expanded mucous gland. Hematoxylin and eosin (H&E) staining, scale bar = 100 μm. (B) The female frog’s liver shows scattered melanomacrophagic aggregates (white arrows), infiltration with inflammatory cells (star), and hydropic degeneration (yellow arrows). H&E staining, scale bar = 100 μm. (C) The female frog’s kidney shows glomerular necrosis (yellow arrows), tubular necrosis (white arrows), and hydropic degeneration due to swelling (stars). H&E staining, scale bar = 100 μm. (D) The female frog’s liver shows red-colored acid-fast bacteria on Ziehl-Neelsen staining, scale bar = 10 μm.
kjvr-20240043f2.jpg
Table 1.
Isolates of bacteria in cases of the gold-spotted frogs
Category Case 1 Case 2
Occurrence 2023-04-01 2023-06-01
Sex Male Female
Body size and weight 120 mm, 91.5 g 95 mm, 46 g
Isolates
 In heart Citrobacter braakii
 In ascitic fluid Delftia acidovorans D. acidovorans
 In subcutaneous materials Elizabethkingia spp. Elizabethkingia spp.
Chryseobacterium indologenes C. indologenes

References

1. Oh HJ, Chang KH, Jin MY, Suh JM, Yoon JD, Shin KH, et al. Trophic ecology of endangered gold-spotted pond frog in ecological wetland park and rice paddy habitats. Animals (Basel). 2021;11:967.
crossref pmid pmc
2. Pessier AP. Management of disease as a threat to amphibian conservation. Int Zoo Yearb. 2008;42:30-39.
crossref
3. Park SG, Ra NY, Yoon JD, Chang MH. Maximum travel distance of Pelophylax chosenicus. Kor J Herpetol. 2018;9:12-16.
4. McCallum ML. Occurrence of lymphedema in wild-caught anurans. J North American Herpetol. 2024;2024:6-10.
crossref
5. Pessier AP. An overview of amphibian skin disease. Semin Avian Exot Pet Med. 2002;11:162-174.
crossref
6. Chai N. Anurans. In: Miller RE, Fowler ME, eds. Fowler’s Zoo and Wild Animal Medicine. 8th ed. Elsevier Saunders; 2015: p1-13.
7. Green SL. Veterinary care. In: Green RE, ed. The Laboratory Xenopus sp. CRC Press; 2010: p69-123.
8. Ferrie GM, Alford VC, Atkinson J, Baitchman E, Barber D, Blaner WS, et al. Nutrition and health in amphibian husbandry. Zoo Biol. 2014;33:485-501.
crossref pmid pmc
9. Alnoaimi F, Dane H, Şişman T. Histopathologic and genotoxic effects of deltamethrin on marsh frog, Pelophylax ridibundus (Anura: Ranidae). Environ Sci Pollut Res Int. 2021;28:3331-3343.
crossref pmid pdf
10. Park IK, Koo KS, Moon KY, Lee JG, Park D. PCR detection of ranavirus from dead Kaloula borealis and sick Hyla japonica tadpoles in the wild. Kor J Herpetol. 2017;8:10-14.
11. Yang HJ, Park SC, Speare R, Kim YJ, Lee H, Min MS. Case report of chytridiomycosis in an exotic frog species, Litoria caerulea, in South Korea. Kor J Herpetol. 2009;1:71-78.
12. Arayan LT, Ngoc Hy TX, Reyes AW, Hop HT, Cho BY, Cho JB, et al. Current prevalence of Batrachochytrium dendrobatidis in imported and native frogs in South Korea. J Prev Vet Med. 2017;41:43-46.
crossref
13. Kamoroff C, Goldberg CS, Grasso RL. Rapid detection of amphibian chytrid fungus Batrachochytrium dendrobatidis using in situ DNA extraction and a handheld mobile thermocycler. Dis Aquat Organ. 2022;152:99-108.
crossref pmid pdf
14. Green SL. Veterinary care. In: Green RE, ed. The Laboratory Xenopus sp. CRC Press; 2010: p19-61.
15. Lee HM, Bae SH, Lee SN, Lee JW, Shin AY, Yu SY, et al. A case of Citrobacter braakii sepsis complicated with hepatocellular carcinoma. Infect Chemother. 2010;42:190-193.
crossref
16. Song EJ, Seon CS, Park SH, Jung JK, Sung SA, Lee SY, et al. A case of Delftia acidovorans peritonitis in a peritoneal dialysis patient managed with preserving the dialysis catheter. Kor J Nephrol. 2011;30:343-345.
17. Zajmi A, Teo J, Yeo CC. Epidemiology and characteristics of Elizabethkingia spp: infections in Southeast Asia. Microorganisms. 2022;10:882.
crossref pmid pmc
18. Hu R, Yuan J, Meng Y, Wang Z, Gu Z. Pathogenic Elizabethkingia miricola infection in cultured black-spotted frogs, China, 2016. Emerg Infect Dis. 2017;23:2055-2059.
crossref pmid pmc
19. Wei D, Cheng Y, Xiao S, Liao W, Yu Q, Han S, et al. Natural occurrences and characterization of Elizabethkingia miricola infection in cultured bullfrogs (Rana catesbeiana). Front Cell Infect Microbiol. 2023;13:1094050.
crossref pmid pmc
20. Michaels CJ, Forsater K. Captive breeding of Pelophylax water frogs under controlled conditions indoors. Herptol Bull. 2017;142:29-34.
TOOLS
METRICS Graph View
  • 0 Crossref
  •  0 Scopus
  • 2,279 View
  • 38 Download
ORCID iDs

Hee-Jong Kim
https://orcid.org/0000-0002-2700-2570

Kwanik Kwon
https://orcid.org/0000-0001-7284-6513

JuDuk Yoon
https://orcid.org/0000-0003-1667-327X

Kyoo-Tae Kim
https://orcid.org/0000-0001-8103-9887

Related articles


About
Policy
Browse articles
For contributors
Editorial Office
#401-1, 85 Bldg., College of Veterinary Medicine, Seoul National University
1 Gwanak-ro, Gwanak-gu, Seoul 08826, Korea
Tel: +82-2-880-1229    Fax: +82-2-878-9762    E-mail: jvs@ksvs.or.kr                

Copyright © 2026 by The Korean Society of Veterinary Science.

Developed in M2PI

Close layer
prev next