Two 6-year-old gold-spotted pond frogs (P. chosenicus) (1 male and 1 female) experienced anorexia, buoyancy without diving, and systemic swelling for 1 month and died several days after (Table 1). For more than 5 years, the frogs have been housed for a conservation study in small groups in polycarbonate tanks with a shallow water environment and a small artificial decoration rock at the Research Center for Endangered Species located in the Middle Eastern area of South Korea (36°64’N, 129°15’E) (Fig. 1A). They were fed with crickets (Acheta demesticus) and sprinkled with minerals and vitamins [8]. Tap water that had stood for 1 day was supplied to the tank. Temperature, humidity, and pH levels were checked daily. The temperature and humidity were maintained at an average of 20℃ to 22℃ and 50% to 60%, respectively. Tank water pH ranged from 8.28 to 8.75. Necropsy was performed according to standard protocol to identify the cause of death [9]. The carcass was severely swollen (Fig. 1B). The dorsal surface of the body was dark green, and the ventral surface and extremities were beige without wounds, ulcers, or nodules. The body length of the 2 frogs was 120 and 95 mm, and the weight was 91.5 and 46 g, respectively. A lumpy translucent exudate was observed around the oral cavity (Fig. 1C). Watery fluid was stored in the abdominal cavity (Fig. 1D). The liver was dark red, with white spots scattered on its surface. The lungs, heart, and kidneys were pale. In the female frog, several protruding dark gray nodules were scattered on the liver surface (Fig. 1E), and the kidneys were fat-like beige (Fig. 1F). Samples, including the heart, liver, kidneys, skin, ascitic fluid, and subcutaneous materials, were collected immediately following death and requested by Green Vet Laboratories (Yongin, Korea). The identification of bacteria was performed using the VITEK 2 system (BioMérieux, France), and histopathological examination was performed using hematoxylin and eosin (H&E) and Ziehl-Neelsen (ZN) staining methods [5,8]. Bacteriologic examination results identified Citrobacter braakii in the heart of the female frog, Delftia acidovorans in the ascitic fluid, and Elizabethkingia spp. and Chryseobacterium indologenes in the subcutaneous materials of both frogs (Table 1). Histopathological examination by H&E staining showed edematous epidermis, enlarged blood vessels, and a longitudinally expanded mucous gland of the skin (Fig. 2A). In the liver, parenchymal and perivascular lesions showed marked infiltration with heterophils and mononuclear inflammatory cells and scattered melanomacrophagic aggregates in the parenchyma. The hepatic sinusoid was unclear owing to extremely abundant inflammatory cells, and fibrous tissues were observed around the site of vascular epithelial degeneration. The liver also showed hydropic degenerations (Fig. 2B). Acid-fast bacteria were also identified in the liver of the female frog using ZN staining (Fig. 2D). In the kidneys, glomerular and tubular necrosis and hydropic degeneration of the renal tube epithelium due to swelling were noted (Fig. 2C). Samples, including the skin, liver, and tank water, underwent polymerase chain reaction (PCR) tests to identify etiologic agents, including Ranavirus and chytrid fungus (Bd) [10,11]. DNA samples were extracted using a DNA Extraction kit (Qiagen Korea, Korea) according to the manufacturer’s guidelines. Identification of Ranavirus was performed using a major capsid protein gene with PCR amplification primers (F:5`GACTTGGCCACTTATGAC3` and R: 5`GTCTCTGGAGAAGAAGAA3`). The presence of chytridiomycosis was investigated using a nested PCR assay to detect Bd [12]. Bd18SF1 (5`TTTGTACACACCGCCGTCGC3`) and Bd28SR1 (5`ATATGCTTAAGTTCAGCGGG3`) were the first used primers. The second PCR test used primer BD1A (5’CAGTGTGCCATATGTCACG3’) and BD2A (5’CATGGTTCATATCTGTCCAG3’) genes as PCR targets, as previously described [10,11,13]. PCR results identified no microorganisms in frogs.

Frog edema disease is a condition characterized by excess fluid accumulation in the body that can lead to swelling, particularly in the abdomen and limbs [7]. It can be caused by several factors, including bacteria, viruses, parasites, nutritional deficiencies, toxins, and environmental stress [4,5]. Tap water contains disinfectants, including chlorine and chloramines, which are unsafe for frogs and must therefore be removed [8]. Chloramines are more stable than chlorine and do not evaporate from the water surface as readily as chlorine; therefore, chloramine levels will not decrease in standing tap water [14]. Consequently, allowing chloraminated tap water to stand for 24 to 36 hours before its use in frog housing tanks is ineffective, and chloramines must be removed by special catalytic carbon-activated filters [8]. Chloramine and chlorine toxicity can be associated with eye irritation, skin sloughing, and acute death in frogs without initial clinical signs [2,7]. In this case, tap water was supplied to the tank after standing for 24 hours without using any filters, which is considered to be one of the causes of edema disease. Frogs can live in water with a pH ranging from 6.0 to 9.0. However, they normally prefer slightly alkaline environments (pH, 7.4-7.5), such as tank water. The pH level influences the 2 forms of ammonia detected in water, including ionized and unionized ammonia [14]. Water with high pH has a higher fraction of unionized ammonia [14]. This study recorded water pH levels of 8.28 to 8.75, presumably indicating alkalinized tank water due to unionized ammonia excreted by the same housing tank water. Gold-spotted pond frogs have average body weight and length of 21.6 ± 1.7 g and 60.4 ± 2.08 mm, respectively [3]. However, in this case, the male and female body weights were 91.5 g and 46 g, and their body lengths were 120 mm and 95 mm, respectively, much larger than the average. Therefore, the body size probably changed owing to edema disease in which subcutaneous water is accumulated. Isolated bacteria, including C. braakii in the heart, D. acidovorans in the ascitic fluid, and Elizabethkingia spp. and C. indologenes in subcutaneous materials, are widely distributed in various water environments [15-17]. Owing to their biofilm-forming ability, bacteria are frequently isolated from tap water, which can resist chlorination and survive in water supplies [17]. Consequently, isolates represent bacteria emerging in human public health that can cause nosocomial and community infections [15,16]. In frogs, Elizabethkingia spp. can cause neurological signs, including wryneck, body bias, cataracts, and meningoencephalitis [17-19]. These clinical signs were not observed in this case; however, they should be noted in various water systems. Furthermore, this microorganism was not isolated from the liver. Instead, acid-fast bacteria were observed, indicating the possibility of Mycobacterium spp., an opportunistic pathogen associated with ulcerative systemic disease and visceral granulomas in amphibians [7]. Thus, the scattered liver nodules are believed to be caused by unidentified Mycobacterium spp. infection. In previous experimental studies, frogs exposed to insecticides developed hepatocyte vacuolization, increased melanomacrophage levels, sinusoidal dilatations, hemorrhage, and congestion in the liver. Additionally, the kidneys showed mononuclear cell infiltration, necrosis, karyolysis, glomerular shrinkage, hemorrhage, and fibrosis in the renal tube epithelium [4,9]. Similar observations, including increased melanomacrophages, fibrosis, inflammatory cell infiltration, liver degeneration, glomerular necrosis, tubular necrosis, and kidney degeneration, were noted in this case. Therefore, the liver and kidneys were damaged, assumingly caused by long-term exposure to chlorine and chloramine. PCR tests for Ranavirus and B. dendrobatidis, which are fatal to amphibians and suspected pathogens in edema disease, were negative [10,12]. Therefore, infection is not considered a cause of edema disease. Edema disease in frogs, also called dropsy, bloat, or hydropsy, presents with lethargy, loss of balance, loss of color, red spots on the skin, and weight loss [2]. Edema can be prevented by providing proper care and housing for the frogs, including clean water, a balanced diet, adequate space, and minimal handling. The disease can be fatal if left untreated; therefore, optimal preventive management is significant [7,14,20].