Molecular and diagnostic study of dermatophytosis in cats in Basrah, Iraq

Article information

Korean J Vet Res. 2025;65.e13
Publication date (electronic) : 2025 June 30
doi : https://doi.org/10.14405/kjvr.20250010
Department of Internal and Preventive Medicine, College of Veterinary Medicine, University of Basrah, Basrah 61004, Iraq
*Corresponding author: Hussein Ali Naji Department of Internal and Preventive Medicine, College of Veterinary Medicine, University of Basrah, Karmat Ali, Basra 61004, Iraq Tel: +964-40- 412714 E-mail: Hussein.naji@uobasrah.edu.iq
Received 2025 February 21; Revised 2025 June 11; Accepted 2025 June 13.

Abstract

Cats can develop skin diseases caused by fungal organisms called dermatophytes, generally called ringworms. Dermatophytosis is a zoonotic disease that can be transmitted from animals to humans and is a worldwide public health issue. This study examined feline dermatophytosis in cats in Basra province – Iraq. Eighty cats of different ages, sexes, and breeds clinically infected with dermatophytosis underwent a fungal culture and molecular analysis. Sixty-nine (86.3%) of the 80 samples were positive on the fungal culture media, but 57 out of the 69 samples were positive for the internal transcribed spacer 1 (ITS1). By contrast, only 41 of the 69 samples tested positive for chitin synthase 1 (specific for Microsporum canis). The isolated M. canis was subjected to sequencing analyses and deposited in the gene bank. In conclusion, this study documented M. canis among infected cats in Basrah, Iraq.

Introduction

Cats can develop skin diseases caused by fungal organisms called dermatophytes, generally known as ringworms. These fungi reside on the feline dermis, fur, and nails and can invade the epidermis, resulting in symptoms such as circular areas of alopecia, inflammation, flaking, and pruritus [1]. Dermatophytes are categorized into 3 distinct families based on their ecological niche, consisting of anthropophiles (found in humans), zoophiles (seen in animals), and geophiles (found in soil) [2]. The primary molecular techniques for identifying dermatophyte species include Multiplex, Nested, real-time polymerase chain reaction (PCR), quantitative PCR, PCR-enzyme-linked immunosorbent assay, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA, and mass spectrophotometry. PCR-based methods have significantly enhanced the accuracy of dermatophyte identification at the inter and intra-specific levels [3].

Many advanced techniques, such as confocal reflection microscopy, are being used to observe the cellular characteristics of the skin during infection, potentially allowing for the detection of dermatophyte fungi [4]. The primary advantage of this test is its non-invasive nature and great sensitivity [5]. Researchers are utilizing immunochromatography, a technology, to identify dermatophytes in skin and nails [6]. Amplification of the universal genes, such as chitin synthetases, or the specified internal transcribed spacer (ITS) region followed by sequencing is the most popular and straightforward way to understand the genomic diversity and molecular distinctions among the isolates of animal and human dermatophytosis [7]. Phylogenetic analysis and the identification of dermatophyte species frequently rely on sequencing the ITS region. Using the ITS region as a target for study, along with complementary fingerprinting techniques such as amplified fragment length polymorphism (AFLP) or RFLP, can provide more valuable insights into the reorganization and taxonomy of Trichophyton. Mentagrophytes, also called M. canis and Trichophyton [8]. The ITS region can be amplified and analyzed using RFLP with a single enzyme, such as MvaI, to identify the species [9].

AFLP is a method used for DNA fingerprinting. This technique combines restriction enzymes to cut DNA into fragments and the selective amplification of these fragments using PCR [10]. Very limited information exists on dermatophytosis in cats in Basrah, Iraq. Therefore, this study isolated and diagnosed the fungi causing dermatophytosis in cats in Basra Governorate, Iraq.

Materials and Methods

Ethical consideration

The present study was conducted in accordance with the rules and guidelines issued by the College of Veterinary Medicine at the University of Basrah. The Committee of Animal Ethics in the College of Veterinary Medicine, University of Basrah, Iraq, approved this project [11].

Study and animal design

This study was conducted from July 1, 2024, to November 30, 2024. Eighty samples clinically infected with dermatophytosis were obtained from various veterinary clinics within Basra province. The skin samples were collected from the cases for laboratory diagnosis at the College of Veterinary Medicine/University of Basra, Basra Veterinary Hospital, and the diagnosis was confirmed at private laboratories [12]. Various clinical specimens, including hair and scabs, were obtained from veterinary clinics in Basrah Governorate. Skin scraping was performed. The collected samples were placed separately in sterile plastic containers for transport to the laboratory to detect dermatophytosis. Each sample was characterized by unique and specific facts. The abraded dermis was collected using a sterilized slide after applying 70% ethanol to the afflicted region. The impacted hair was extracted using a sterilized pair of forceps [13].

Isolation and identification of dermatophytes

The samples were cultured on Sabouraud dextrose agar (SDA; Oxoid Company, United Kingdom) and dermatophyte test medium (DTM; Oxoid Company) with the addition of (500 mg/L) cycloheximide to prevent the growth of non-dermatophyte mold and (250 mg/L) chloramphenicol to minimize contamination from rapidly growing bacteria. The cultures were incubated at 28°C±1°C for 14 to 21 days. The Petri dishes were inspected daily after seven to 14 days and examined macroscopically and microscopically to identify dermatophytes sp. [1417].

Molecular detection

DNA extraction of the positive samples

The freshly grown fungal colonies and hyphae were harvested from the DTM and SDA surface and frozen at –80°C for DNA fungal extraction using (Promega, USA) according to the manufacturer’s instructions.

PCR DNA sequencing and analysis

Two PCR runs were performed with 2 primer sets. The first primer set (universal primer) for fungal identification targeting the ribosomal gene (ITS) set flanked (600) base pairs (bp) ITS1 forward (TCCGTAGGTGAACCTGCGG) and ITS4 reverse (TCCTCCGCTTATTGATATGC) [18,19]. The second M. canis primer set targeted the (chitin synthase 1) (450) bp forward (CATCGAGTACATGTGCTCGC) and reverse (CTCGAGGTCAAAAGCACGCC). The primers were designed by Integrated DNA Technologies (IDT Company, Canada).

All PCRs for detecting the dermatophytosis gene were performed in a 20 µL volume. The reaction mixture contained 10 µL master max, 4 µL for each forward and reserve primer (0.5 pmol/20 µL), 5µL PCR water, and 1 µL template DNA. The amplification reaction was performed using a DNA and thermo-cycler; 1.5% agarose gel electrophoresis was performed with ethidium bromide staining under ultraviolet light.

Amplicon sequencing and analysis

The amplicons were selected from the positive PCR samples for sequencing using the Sanger method at (Macrogen, Korea). Once the generated sequences were obtained, they were trimmed from the noisy signals and deposited in the gene bank (NCBI). After obtaining the relevant accession numbers, they were analyzed for the phylogeny and compared with other global strains. DNA sequencing analysis (phylogenetic tree analysis) was conducted using Molecular Evolutionary Genetics Analysis ver. 10.0 (Mega X; Mega across Computing Platforms, https://www.megasoftware.net/) and multiple sequence alignment analysis based on Clustal W alignment analysis. The results were compared with the global resistance and susceptible strains. Phylogenetic tree analysis was constructed by a comparison with NCBI-Blast known sequences. This analysis was conducted using the software from the following reference [20,21].

Statistical analysis

All data were analyzed using Microsoft Excel software to determine the status and percentage of positive samples for dermatophytosis in cats in Basra, Iraq.

Results

Of the 80 samples clinically positive for infection with dermatophytosis, 69 (86.3%) samples tested positive after culturing on SDA and DTM. Morphological (macroscopic and microscopic) approaches were first applied to identify growth, followed by molecular identification. The growth on SDA revealed colonies of M. canis that were characterized by the white to yellow color, while on DTM, they were characterized by the white color and the soft and fluffy appearance in the center with the red agar color (converted from orange to red color). These were critical for confirming the diagnosis of dermatophytosis because these media are designed specifically to support the growth of fungi while inhibiting the growth of bacterial contaminants (Figs. 1, 2).

Fig. 1.

Colonies of Microsporum canis are characterized by white to yellow color on Sabouraud dextrose agar media.

Fig. 2.

Colonies of Microsporum canis on dermatophyte test medium agar characterized by white, soft and fluffy in the center with red color of agar (converted orange to red color).

Molecular identification of M. canis from cats

The PCR results showed that 57 out of 69 samples tested positive for ITS1, whereas only 41 samples tested positive for chitin synthase 1 (specific for M. canis), as shown in Figs. 3, 4.

Fig. 3.

Agarose gel electrophoresis image (1.5% agarose) shows the amplicons targeting ITS1 gene (as universal primers for fungi) (size = 600 base pairs [bp]) (1–12) while C is control negative in which similar polymerase chain reaction (PCR) conditions were used except water was added instead of DNA. M is molecular marker (100-3,000 bp) from GeneDirex (Korea). Gradient results to find the optimal annealing temperature for ITS1 gene amplification. This achieved by using similar PCR conditions and components except the annealing temperature.

Fig. 4.

Agarose gel electrophoresis image (1.5% agarose) shows the amplicons of chitin synthase 1 (specific for Microsporum canis) (size = 450 base pairs [bp]) (1–6) while C is control negative in which similar polymerase chain reaction conditions were used except water was added instead of DNA. M is molecular marker (100-3,000 bp) from GeneDirex (Korea).

Phylogenetic analysis

An analysis of the phylogenetic tree based on local fungi (partial ITS1 gene) and local M. canis (partial chitin synthase 1 gene) was performed. The results according to the NCBI-BLAST Homology Sequence identity (%) in local fungi (partial ITS1 gene) with deposited accession numbers (PQ578761 M. canis, Iraq, PQ578762 M. canis India, PQ578763 M. canis Iraq, PQ578764 M. canis India, PQ578765 M. canis Iraq, and PQ578766 M. canis Japan) were compared with other sequences, as shown in Fig. 5. The results according to NCBI-BLAST Homology Sequence identity (%) in local M. canis (partial chitin synthase 1 gene) with the deposited accession numbers (PQ588604 M. canis USA, PQ588605 M. canis USA, PQ588606 M. canis USA, PQ588607 M. canis Italy, PQ588608 M. canis Italy and PQ588609 M. canis Italy) were compared with other sequences (Fig. 6).

Fig. 5.

Evolutionary tree analyzed by Maximum Likelihood method conducted in MEGA11. The local isolates were referred as red circles while other sequences as blue circles. This was inferred by using the Tamura-Nei model. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. This analysis involved 12 nucleotide sequences. There were total of 489 positions in the final dataset.

Fig. 6.

Evolutionary analysis of partial chitin synthase 1 gene by Maximum Likelihood method conducted in MEGA11. The evolutionary history was inferred by using Tamura-Nei model. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. There were total of 366 positions in the final dataset.

Discussion

Dermatophytosis is a ubiquitous and contagious superficial skin disease of cats. In animals, the disease is commonly caused by M. canis and Trichophyton species [2225]. In the present study, 2 different media, SDA and DTM, were used to grow and diagnose dermatophytes. These media help distinguish between dermatophytes and non-pathogenic fungi because DTM contains a pH indicator that changes to red when dermatophytes grow, facilitating the diagnosis. The results showed that 69 out of 80 (86.3%) samples exhibited dermatophyte growth, reflecting the widespread prevalence of an infection among the tested samples. This percentage indicates the familiar presence of dermatophytes in cats, supporting the need for regular screening, especially in environments with large animals. Similar results have been reported elsewhere [26,27]. On the other hand, 11 (13.8%) samples showed no growth, possibly due to contamination with other fungi Spp, which inhibit or prevent the pathogenic dermatophytosis of infection, or the samples were affected by different factors such as 5 which may hinder the growth of fungi, such as the lack of fungi in the sample itself, which appears to agree with previous studies [26,28].

The colonies of dermatophytes, such as M. canis, have distinctive shapes when grown on culture media such as SDA and DTM. Some of the characteristics of these colonies are as follows. M. canis color colonies are white to yellow and usually exhibit a smooth, velvety surface. The surface appears velvety or cottony and is often dense. The underside appears dark yellow to orange, which agrees with previous work [29,30].

Trichophyton spp. colonies are thinner than M. canis and may range in color from white to gray. The surface often appears dendritic or velvety. The color on the underside varies from dark brown to yellow or orange. DTM medium contains a pH indicator, which turns the medium from yellow to red when dermatophytes are growing because of their alkaline secretions. This color change is an essential indicator for distinguishing dermatophytes from other fungi [31,32]. These phenotypic characteristics are used to rapidly identify dermatophytes and aid in early diagnosis, especially when a cat infection is suspected [3336].

In the present study, 57 out of 69 samples tested positive for ITS1, while only 41 samples tested positive for chitin synthase 1 (specific for M. canis). The percentage of the ITS1 gene supported the results of cultured media in this study, while the low number of isolates identified using the chitin synthase 1 gene may be due to the low DNA concentration, which was less than 10 μg/μL in the samples tested. The nanodrop results also produced a negative result, and the chitin layer in the dermatophyte wall was very thick, which may have resulted in low concentrations of DNA extracts (4 to 5 μg) being overlooked. Therefore, only 12 (ITS1) and 28 (Chs1) samples of the 69 samples showed low concentrations. Accordingly, the molecular method has higher sensitivity and accuracy in distinguishing Microsporum species and is more accurate than the culture test. Moreover, its widespread use in diagnosis will be of great benefit. In addition to demonstrating the importance of the ITS1 region from a taxonomic perspective, agarose gel electrophoresis (1.5% agarose) images of amplicons obtained from gradient PCR (between 50°C to 60°C) targeting the ITS1 genes (600 bp in size) are shown. Hence, all temperatures used were optimal for DNA amplification. The molecular marker sequence database (ranging between 1,000–300 bp) also showed that morphologically identifiable fungi and morphologically unidentifiable fungal strains could be identified using this system. This ITS1-based system is accurate and applicable even to strains with atypical morphological features, and these results are consistent with previous studies [21,3739].

The 6 local strains ranged from 99% to 100% homology because of point mutations at various positions. Although all strains were from the same area, the phylogenetic tree consisted of 6 isolates based on the sequence numbers obtained, where the present M. canis isolates (PQ578761, PQ578762, PQ578763, PQ578764, PQ578765, and PQ578766) are located close to the Iraq isolate (from another study) and other isolates from India and Japan [4042]. The phylogenetic data extracted from the partial sequencing of the 18s rRNA gene showed that M. canis is located on the same node (with a reassignment value ranging from 99%–100%). Accordingly, the source of a dermatophyte infection in cats may have been due to the importation of animals from neighboring and non-neighboring countries to Iraq because a strong match was observed between the sequences described in the literature and the sequences identified in the present study. These results are consistent with previous studies [34,43,44].

The results according to NCBI-BLAST Homology Sequence identity (100%) in local M. canis (partial chitin synthase 1 gene) with deposited accession numbers (PQ588604, PQ588605, PQ588606, PQ588607, PQ588608, and PQ588609) are located in USA and Italy only, indicating that the present strain has been documented for first time in Iraq. This strain may have entered Iraq via infected cats imported from Europe or the USA because this gene has not been observed previously in Iraq but has been reported elsewhere [4547].

Notes

The authors declare no conflict of interest.

Author’s Contributions

Conceptualization: Naji HA; Data Curation: Naji HA; Formal analysis: Naji HA; Funding acquisition: Naji HA; Investigation: Khalaf NA; Methodology: Khalaf NA; Project administration: Naji HA; Resources: Khalaf NA; Supervision: Naji HA; Visualization: Naji HA; Writing–original draft: Khalaf NA; Writing–review& editing: Naji HA.

Funding

This research was supported by the College of Veterinary Medicine, University of Basrah, in August 2024.

Acknowledgments

The authors grateful the Staff the College of Veterinary Medicine, University of Basrah, Iraq, for for providing the necessary assistance and resources for the study project.

Data Availability Statement

The datasets used and/or analysed during the current study are available from the corresponding author upon reasonable request.

References

1. Alautaish HH, Naji HA, Saud ZA. Clinical study of common bacterial, fungal and parasitic skin diseases in cats. Adv Life Sci 2024;11:580–584. 10.62940/als.v11i3.1873.
2. Arabatzis M, Bruijnesteijn van Coppenraet LE, Kuijper EJ, de Hoog GS, Lavrijsen AP, Templeton K, et al. Diagnosis of common dermatophyte infections by a novel multiplex real-time polymerase chain reaction detection/identification scheme. Br J Dermatol 2007;157:681–689. 10.1111/j.1365-2133.2007.08100.x. 17672875.
3. Ciesielska A, Kawa A, Kanarek K, Soboń A, Szewczyk R. Metabolomic analysis of Trichophyton rubrum and Microsporum canis during keratin degradation. Sci Rep 2021;11:3959. 10.1038/s41598-021-83632-z. 33597693.
4. Grice EA, Segre JA. The skin microbiome. Nat Rev Microbiol 2011;9:244–253. 10.1038/nrmicro2537. 21407241.
5. Baert F, Stubbe D, D'hooge E, Packeu A, Hendrickx M. Updating the taxonomy of dermatophytes of the BCCM/IHEM collection according to the new standard: a phylogenetic approach. Mycopathologia 2020;185:161–168. 10.1007/s11046-019-00338-7. 31093849.
6. Chen L, Shi GY, Wang MM, Zhao LL, Huang YY, Chen XL, et al. Morphological and molecular identification of two strains of dermatophytes. J Huazhong Univ Sci Technolog Med Sci 2013;33:917–922. 10.1007/s11596-013-1222-8. 24337859.
7. Bernhardt A, von Bomhard W, Antweiler E, Tintelnot K. Molecular identification of fungal pathogens in nodular skin lesions of cats. Med Mycol 2015;53:132–144. 10.1093/mmy/myu082. 25550386.
8. Boehm TM, Mueller RS. Dermatophytosis in dogs and cats: an update. Tierarztl Prax Ausg K Kleintiere Heimtiere 2019;47:257–268. 10.1055/a-0969-1446. 31434126.
9. Brilhante RS, Cavalcante CS, Soares-Junior FA, Cordeiro RA, Sidrim JJ, Rocha MF. High rate of Microsporum canis feline and canine dermatophytoses in Northeast Brazil: epidemiological and diagnostic features. Mycopathologia 2003;156:303–308. 10.1023/b:myco.0000003582.67122.69. 14682455.
10. Cafarchia C, Gasser RB, Figueredo LA, Weigl S, Danesi P, Capelli G, et al. An improved molecular diagnostic assay for canine and feline dermatophytosis. Med Mycol 2013;51:136–143. 10.3109/13693786.2012.691995. 22686247.
11. Dhib I, Fathallah A, Yaacoub A, Hadj Slama F, Said MB, Zemni R. Multiplex PCR assay for the detection of common dermatophyte nail infections. Mycoses 2014;57:19–26. 10.1111/myc.12096. 23734576.
12. Kano R, Nakamura Y, Watari T, Watanabe S, Takahashi H, Tsujimoto H, et al. Phylogenetic analysis of 8 dermatophyte species using chitin synthase 1 gene sequences. Mycoses 1997;40:411–414. 10.1111/j.1439-0507.1997.tb00176.x. 9470404.
13. Garg J, Tilak R, Singh S, Gulati AK, Garg A, Prakash P, et al. Evaluation of pan-dermatophyte nested PCR in diagnosis of onychomycosis. J Clin Microbiol 2007;45:3443–3445. 10.1128/jcm.02367-06. 17699656.
14. Ebihara M, Makimura K, Sato K, Abe S, Tsuboi R. Molecular detection of dermatophytes and nondermatophytes in onychomycosis by nested polymerase chain reaction based on 28S ribosomal RNA gene sequences. Br J Dermatol 2009;161:1038–1044. 10.1111/j.1365-2133.2009.09249.x. 19566663.
15. Gupta AK, Zaman M, Singh J. Fast and sensitive detection of Trichophyton rubrum DNA from the nail samples of patients with onychomycosis by a double-round polymerase chain reaction-based assay. Br J Dermatol 2007;157:698–703. 10.1111/j.1365-2133.2007.08110.x. 17714569.
16. Friedman D, Friedman PC, Gill M. Reflectance confocal microscopy: an effective diagnostic tool for dermatophytic infections. Cutis 2015;95:93–97. 25750962.
17. Khan S, Farabi B, Navarrete-Dechent C, Rao B, Safai B. Applications of reflectance confocal microscopy in the diagnosis of fungal infections: a systematic review. J Fungi (Basel) 2022;9:39. 10.3390/jof9010039. 36675860.
18. Gnat S, Łagowski D, Nowakiewicz A. Major challenges and perspectives in the diagnostics and treatment of dermatophyte infections. J Appl Microbiol 2020;129:212–232. 10.1111/jam.14611. 32048417.
19. Currie BJ. Group A streptococcal infections of the skin: molecular advances but limited therapeutic progress. Curr Opin Infect Dis 2006;19:132–138. 10.1097/01.qco.0000216623.82950.11. 16514337.
20. Hamied AS, Alnedawy Q. Molecular identification of Microsporum canis isolated from infected children with Tinea corporis and Tinea capitis in Baghdad. Iraqi J Sci 2024;32:5432–5438. 10.24996/ijs.2024.65.10.8.
21. Nardoni S, Franceschi A, Mancianti F. Identification of Microsporum canis from dermatophytic pseudomycetoma in paraffin-embedded veterinary specimens using a common PCR protocol. Mycoses 2007;50:215–217. 10.1111/j.1439-0507.2007.01368.x. 17472620.
22. Higashi Y, Miyoshi H, Takeda K, Saruwatari H, Kubo H, Sakaguchi I, et al. Evaluation of a newly-developed immunochromatography strip test for diagnosing dermatophytosis. Int J Dermatol 2012;51:406–409. 10.1111/j.1365-4632.2011.05046.x. 22435427.
23. Nejati-Hoseini R, Zarrinfar H, Parian M, Parham S, Fata A, Rezaei-Matehkolaei A, et al. Identification of dermatophytosis agents in Mashhad, Iran, by using polymerase chain reaction sequencing (PCR Sequencing) method. J Isfahan Med Sch 2019;37:256–262.
24. Ibrahim MA, Abdel-Latef GK, Abdel-Rahim MM, Aziz SA. Epidemiologic and molecular characterization of zoonotic dermatophytes from pet dogs and cats in Egypt. Adv Anim Vet Sci 2021;9:2225–2233.
25. da Cunha MM, Capote-Bonato F, Capoci IR, Bonato DV, Ghizzi LG, Paiva-Lima P, et al. Epidemiological investigation and molecular typing of dermatophytosis caused by Microsporum canis in dogs and cats. Prev Vet Med 2019;167:39–45. 10.1016/j.prevetmed.2019.03.019. 31027719.
26. Jarjees KI, Issa NA. First study on molecular epidemiology of dermatophytosis in cats, dogs, and their companions in the Kurdistan region of Iraq. Vet World 2022;15:2971–2978. 10.14202/vetworld.2022.2971-2978. 36718337.
27. Lavari A, Eidi S, Soltani M. Molecular diagnosis of dermatophyte isolates from canine and feline dermatophytosis in Northeast Iran. Vet Med Sci 2022;8:492–497. 10.1002/vms3.698. 34919354.
28. Mancianti F, Nardoni S, Cecchi S, Corazza M, Taccini F. Dermatophytes isolated from symptomatic dogs and cats in Tuscany, Italy during a 15-year-period. Mycopathologia 2002;156:13–18. 10.1023/a:1021361001794. 12715942.
29. Katiraee F, Kouchak Kosari Y, Soltani M, Shokri H, Hassan Minooieanhaghighi M. Molecular identification and antifungal susceptibility patterns of dermatophytes isolated from companion animals with clinical symptoms of dermatophytosis. J Vet Res 2021;65:175–182. 10.2478/jvetres-2021-0020. 34250302.
30. Segal E, Elad D. Human and zoonotic dermatophytoses: epidemiological aspects. Front Microbiol 2021;12:713532. 10.3389/fmicb.2021.713532. 34421872.
31. Ma X, Liu Z, Yu Y, Jiang Y, Wang C, Zuo Z, et al. Microsporum gypseum isolated from Ailuropoda melanoleuca provokes inflammation and triggers Th17 adaptive immunity response. Int J Mol Sci 2022;23:12037. 10.3390/ijms231912037. 36233337.
32. Jacobson LS, McIntyre L, Mykusz J. Comparison of real-time PCR with fungal culture for the diagnosis of Microsporum canis dermatophytosis in shelter cats: a field study. J Feline Med Surg 2018;20:103–107. 10.1177/1098612x17695899. 29172910.
33. Moskaluk AE, VandeWoude S. Current topics in dermatophyte classification and clinical diagnosis. Pathogens 2022;11:957. 10.3390/pathogens11090957. 36145389.
34. Mancianti F, Nardoni S, Corazza M, D'Achille P, Ponticelli C. Environmental detection of Microsporum canis arthrospores in the households of infected cats and dogs. J Feline Med Surg 2003;5:323–328. 10.1016/s1098-612x(03)00071-8. 14623201.
35. Naji HA, Saud ZA, Saleh WM, Alsaad IA. Sero prevalence of Schmallenberg virus antibodies in buffalo from north Basra Governorate-Iraq. Vet Pract 2021;22:14–17.
36. Segal E, Frenkel M. Dermatophyte infections in environmental contexts. Res Microbiol 2015;166:564–569. 10.1016/j.resmic.2014.12.007. 25634072.
37. Machouart-Dubach M, Lacroix C, de Chauvin MF, Le Gall I, Giudicelli C, Lorenzo F, et al. Rapid discrimination among dermatophytes, Scytalidium spp., and other fungi with a PCR-restriction fragment length polymorphism ribotyping method. J Clin Microbiol 2001;39:685–690. 10.1128/jcm.39.2.685-690.2001. 11158128.
38. Nardoni S, Mugnaini L, Papini R, Fiaschi M, Mancianti F. Canine and feline dermatophytosis due to Microsporum gypseum: a retrospective study of clinical data and therapy outcome with griseofulvin. J Mycol Med 2013;23:164–167. 10.1016/j.mycmed.2013.05.005. 23827239.
39. Brilhante RS, Rocha MF, Cordeiro RA, Rabenhorst SH, Granjeiro TB, Monteiro AJ, et al. Phenotypical and molecular characterization of Microsporum canis strains in north-east Brazil. J Appl Microbiol 2005;99:776–782. 10.1111/j.1365-2672.2005.02685.x. 16162228.
40. Naseif TS, Mohammed AJ, Abbas HS. Molecular identification of the dermatophytes causing tinea diseases using ITS sequencing analysis. Med Leg Update 2020;20:1641–1648.
41. Cafarchia C, Romito D, Sasanelli M, Lia R, Capelli G, Otranto D. The epidemiology of canine and feline dermatophytoses in southern Italy. Mycoses 2004;47:508–513. 10.1111/j.1439-0507.2004.01055.x. 15601458.
42. Yamada S, Anzawa K, Mochizuki T. An epidemiological study of feline and canine dermatophytoses in Japan. Med Mycol J 2019;60:39–44. 10.3314/mmj.19.001. 31155570.
43. Oladzad V, Nasrollahi Omran A, Haghani I, Nabili M, Guillot J, Seyedmousavi S, et al. Asymptomatic colonization of stray dogs and domestic cats with Trichophyton mentagrophytes II in Northern Iran. J Mycol Med 2024;34:101496. 10.1016/j.mycmed.2024.101496. 38986423.
44. Kasperova A, Kunert J, Raska M. The possible role of dermatophyte cysteine dioxygenase in keratin degradation. Med Mycol 2013;51:449–454. 10.3109/13693786.2013.794310. 23758130.
45. Quinn PJ, Markey BK, Leonard FC, Hartigan P, Fanning S, Fitzpatrick E. Veterinary Microbiology and Microbial Disease 2nd edth ed. John Wiley & Sons; 2011. p. 413–3.
46. Umar L, Mansir L, Sani MG. Phytochemical analysis and antifungal activity of Ficus sycomorus L. (Moraceae) extracts on some dermatophytic fungi. UMYU J Microbiol Res 2022;6:11–17. 10.47430/ujmr.2161.002.
47. DeBoer DJ, Moriello KA. Development of an experimental model of Microsporum canis infection in cats. Vet Microbiol 1994;42:289–295. 10.1016/0378-1135(94)90060-4. 9133054.

Article information Continued

Fig. 1.

Colonies of Microsporum canis are characterized by white to yellow color on Sabouraud dextrose agar media.

Fig. 2.

Colonies of Microsporum canis on dermatophyte test medium agar characterized by white, soft and fluffy in the center with red color of agar (converted orange to red color).

Fig. 3.

Agarose gel electrophoresis image (1.5% agarose) shows the amplicons targeting ITS1 gene (as universal primers for fungi) (size = 600 base pairs [bp]) (1–12) while C is control negative in which similar polymerase chain reaction (PCR) conditions were used except water was added instead of DNA. M is molecular marker (100-3,000 bp) from GeneDirex (Korea). Gradient results to find the optimal annealing temperature for ITS1 gene amplification. This achieved by using similar PCR conditions and components except the annealing temperature.

Fig. 4.

Agarose gel electrophoresis image (1.5% agarose) shows the amplicons of chitin synthase 1 (specific for Microsporum canis) (size = 450 base pairs [bp]) (1–6) while C is control negative in which similar polymerase chain reaction conditions were used except water was added instead of DNA. M is molecular marker (100-3,000 bp) from GeneDirex (Korea).

Fig. 5.

Evolutionary tree analyzed by Maximum Likelihood method conducted in MEGA11. The local isolates were referred as red circles while other sequences as blue circles. This was inferred by using the Tamura-Nei model. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. This analysis involved 12 nucleotide sequences. There were total of 489 positions in the final dataset.

Fig. 6.

Evolutionary analysis of partial chitin synthase 1 gene by Maximum Likelihood method conducted in MEGA11. The evolutionary history was inferred by using Tamura-Nei model. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. There were total of 366 positions in the final dataset.